Penicillium simile Davolos et al. (ATCC® MYA-4591)

Strain Designations: ROHB 111A  /  Product Format: frozen

Strain Designations ROHB 111A
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (INAIL-Research Area, Italy)
Morphology On potato dextrose agar after 15 days at 25°C, conidiophores biverticillate, conidia round and smooth.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCCGTAAGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCGCCGAAGACATCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTATAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAAATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

Morphology On potato dextrose agar after 15 days at 25°C, conidiophores biverticillate, conidia round and smooth.
Name of Depositor O Maggi
Special Collection ATCC
Chain of Custody
ATCC <-- O Maggi
Isolation
Air in a restoration laboratory at Castel Gandolfo, Rome, Italy.
References

Davolos D, et al. Penicillium simile sp. nov. revealed by morphological and phylogenetic analysis. Int J Syst Evol Microbiol 62: 451-458, 2012. PubMed: 21460135