Penicillium simile Davolos et al. (ATCC® MYA-4591)

Strain Designations: ROHB 111A  /  Product Format: frozen

Strain Designations ROHB 111A
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain yes
Preceptrol® no
Morphology

On potato dextrose agar after 15 days at 25C, conidiophores biverticillate, conidia round and smooth.

Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCCGTAAGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCGCCGAAGACATCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTATAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAAATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

Morphology

On potato dextrose agar after 15 days at 25C, conidiophores biverticillate, conidia round and smooth.

Name of Depositor O Maggi
Special Collection ATCC
Chain of Custody
ATCC <-- O Maggi
Isolation
Air in a restoration laboratory at Castel Gandolfo, Rome, Italy.
References

Davolos D, et al. Penicillium simile sp. nov. revealed by morphological and phylogenetic analysis. Int. J. Syst. Evol. Microbiol., in press (doi: 10.1099/ijs.0.031682-0).