Penicillium meloforme Udagawa et Horie (ATCC® 74184)

Strain Designations: C39686  /  Product Format: frozen

Deposited As Eupenicillium brefeldianum (Dodge) Stolk et Scott
Strain Designations C39686
Application
produces 1H-cycloundeca[1,2-B:5,6-B'] biscyclohepta(B)pyrans
produces eupenifeldin
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Preceptrol® no
Medium ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTCATGGCCGCCGGGGGGCACCCGCCCCCGGGCCCGTGCCCGCCGAAGACACCCCTGAACGCTGTCTGAAGATTGCAGTCTGAGCGATTAGCTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGCCCCCCGGTCCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGCCGGCGACCCCCATCAATCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG



D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGAGCGGCCCCCATCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGATGGGGTGCCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCAGGGTTCAGCCGGCACTCGTGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCTCGGAATGTAACGCCCCCCGGGGCGTCTTATAGCCGAGGGTGCCATGCGGCCAGCCCGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAGCGA



Beta-tubulin (BenA) partial gene

TGGTACGTGCCACGCCCGCCAAAAAACATCCCCAGCACAACAAAGCAACCCCCCAATTGCGAGTCTCAATGGGCAGAACATACTGACTCGAACTACAGGCAGACCATTGCTGGTGAGCACGGCCTTGACGGCGATGGCCAGTAAGTTTCTTCGATACCACTCGATACCACTCGACGCGGAATGGCGGTCTGATGTTTTTGGCTAGCTACAATGGTACCTCCGACCTCCAGCTGGAGCGCTTGAACGTCTACTTCACCCACGTAAGTTGCGTGTCCATTTAACGCAGAAACGCCGGAATCGACTCTAACCCATGGATGTTTTGTTTTTTAGGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGATCTGGAGCCTGGTACCATGGATGCTGTCCGTGCCGGTCCCTTTGGCAAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCCGGTAACAACTGGGCCAAGGGT

Name of Depositor Bristol-Myers Squibb Co.
U.S. Patent Number
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Special Collection NCRR Contract
Isolation
Soil, Shimane, Japan
References

Mayerl F, et al. 1H-cycloundeca[1,2-B:5,6-B']biscyclohepta(B)pyrans usefuel as antitumor agents. US Patent 5,284,866 dated Feb 8 1994

Mayerl F, et al. Eupenifeldin, a novel cytotoxic bistropolone from Eupenicillium brefeldianum. J. Antibiot. 46: 1082-1088, 1993. PubMed: 8360103