Neurospora sitophila Shear et Dodge, teleomorph (ATCC® 36935)

Strain Designations: NRRL 2884  /  Product Format: freeze-dried

Strain Designations NRRL 2884
Application
degrades cellulose
produces glucosidase, beta; acid Glucosidase, beta, acid, glucocerebrosidase
produces protease nonstructural protein 3
produces single-cell protein SCP
produces single-cell protein from cellulose
reduces chemical oxygen demand (COD) of potato effluent
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Mating Type mating type minus
Comments Impeller-associated shear effects during fermentation

The DNA sequences indicate that this strain is phylogenetically closer to Neurospora intermedia than Neurospora sitophila.
Morphology After 5 days on Neurospora medium at 25°C, colony is low, velutinous, buff-colored. Hyphae hyaline, geniculate. After 2 months, arthroconidia abundant, ellipsoidal or irregularly shaped.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 331: Neurospora culture agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCCACAAACCATCGCGAATCTTACCCGTACGGTTGCCTCGGCGCTGGCGGTCCGGAAAGGCCCTCGGGCCCTCCCGGATCCTCGGGTCTCCCGCTCGCGGGAGGCTGCCCGCCGGAGTGCCGAAACTAAACTCTTGATATTTTATGTCTCTCTGAGTAAACTTTTAAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCTCGCCAGTATTCTGGCGAGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCTCTGCTTGCGTTGGGGATCCGCGGCTGTCCGCGGTCCCTCAAAATCAGTGGCGGGCTCGCTAGTCACACCGAGCGTAGTAACTCTACATCGCTATGGTCGTGCGGCGGGTTCTTGCCGTAAAACCCCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGAAGCTTTTGGTGAGGCACCTTCTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATAGTCGGATGCCGATCCAATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGTGACCAGACTTGCGCCGTTCCGATCATCCGGTGTTCTCACCGGTGCACTCGGGACGGCTCAGGCCAGCATCGGTTTTGGCGGGGGGATAAAGGTTCGGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCCGGGCGTAATGCCCTCGCCGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAACGAC

Morphology After 5 days on Neurospora medium at 25°C, colony is low, velutinous, buff-colored. Hyphae hyaline, geniculate. After 2 months, arthroconidia abundant, ellipsoidal or irregularly shaped.
Name of Depositor NRRL
References

. . Prog. Biotechnol. 9: 961-964, 1994.

. . Biotechnol. Lett. 14: 863-868, 1992.

. . Resour. Conserv. Recycl. 13: 139-146, 1995.

Beuchat LR, Basha SM. Protease production by the ontjom fungus, Neurospora sitophila. Eur. J. Appl. Microbiol. 2: 195-203, 1976.

Karim MI, Sistrunk WA. Efficiency of selected strains of fungi in reducing chemical oxygen demand in wastewater from steam-peeled potatoes. J. Food Process Preserv. 8: 211-218, 1984.

Oguntimein GB, Moo-Young M. Production and properties of beta-glucosidase by Neurospora sitophila. World J. Microbiol. Biotechnol. 7: 4-11, 1991.