Penicillium cremeogriseum Chalabuda (ATCC® 18323)

Strain Designations: VKM F-1034 [ATCC 18320, CBS 223.66, FRR 1734, IMI 197492, NRRL 3389]  /  Product Format: freeze-dried

Deposited As Penicillium cremeogriseum Chalabuda
Strain Designations VKM F-1034 [ATCC 18320, CBS 223.66, FRR 1734, IMI 197492, NRRL 3389]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Morphology After 5 days on Blakeslee’s MEA at 25°C, colonies are grey or greyish-green, low, velutinous or cottony, reverse pale yellow. Conidia subspherical or ellipsoidal, smooth-walled.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCATACCTAGTTGCTTCGGCGGGCCCGCCGTCATGGCCGCCGGGGGGCACCCGCCCCCGGGCCCGCGCCCGCCGAAGCCCCCCCTGAACGCTGTCTGAAGATTGCAGTCTGAGCGATTAGCTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGCCCCCCGGCTCCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGCCGGCGACCCCCCTCAATCTTTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGAGCGGCCCCCATCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGATGGGGTGCCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGGGGTTCAGCCGGCCTTCGGGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCTCGGAATGTAACGCCCCCCGGGGCGTCTTATAGCCGAGGGTGCCATGCGGCCAGCCCGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAGCGAC

Morphology After 5 days on Blakeslee’s MEA at 25°C, colonies are grey or greyish-green, low, velutinous or cottony, reverse pale yellow. Conidia subspherical or ellipsoidal, smooth-walled.
Name of Depositor VKM - All Union Collection of Microoganisms
Chain of Custody
ATCC <-- VKM - All Union Collection of Microoganisms <-- T.V. Chalabuda
Isolation
Forest soil, USSR
Cross References

Nucleotide (GenBank) : KU933446 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU933422 D1/D2 region of 28S rRNA gene

References

Chalabuda TV. Species novae e genere Penicillium Link. Not Syst Crypt Inst Bot Acad Sci USSR 6: 161-169, 1950.

Houbraken J, et al. Penicillium araracuarense sp. nov., Penicillium elleniae sp. nov., Penicillium penarojense sp. nov., Penicillium vanderhammenii sp. nov. and Penicillium wotroi sp. nov., isolated from leaf litter. Int J Syst Evol Microbiol 61: 1462-1475, 2011. PubMed: 20639229

Sonjak S, et al. Penicillium svalbardense, a new species from Arctic glacial ice. Antonie van Leeuwenhoek 92: 43-51, 2007. PubMed: 17252316