Penicillium rugulosum Thom, anamorph (ATCC® 10128)

Strain Designations: NRRL 1045 [46, CBS 371.48, IMI 40041, QM 7661]  /  Product Format: freeze-dried

Strain Designations NRRL 1045 [46, CBS 371.48, IMI 40041, QM 7661]
Application
produces rugulosin
produces skyrin
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain yes (type strain)
Intended Use
Preceptrol® no
Medium ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
Growth Conditions
Temperature: 24.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CGAGGTCACCGAAGGTAGACGGGCCCCGAAGGGTCGCCTGGAGGAAGACCAGCGCCGACGAGTCCGTCCCGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCCGACGCGGCGCCGCCACTGCCTTTGGGGCGTGTCCCCGGGGGGACAACACCCAACACCCAGCCGGGCTGGAGGGCAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAATGATTTAATCATAGACTCAGACTCACTATTCAGACAGGGTTCCAGGGCGCTTCGGCGGGCGCGGACCCGGGGGCAGAAGCCCCCCGGCGACCGGGGCCAGGCCCCAGTGGGCCCGCCGAGGCAACGCGGTCATGGTAAACACGGGTGGGAGGTTGGGCTCGTTGGAACCCGCACTC

Name of Depositor NRRL
Chain of Custody
ATCC <<--NRRL<<--C. Thom 46
Isolation
rotting potato, Connecticut
References

Dacre JC, et al. Studies in the biochemistry of micro-organisms. 95. Rugulosin, a crystalline colouring matter of Penicillium rugulosum Thom. Biochem. J. 60: 618-626, 1955. PubMed: 13249956

Thom C. Cultural studies of species of Penicillium. U.S. Dep. Agric. Bur. Anim. Ind. 118: 1-109, 1910.

type strain

type strain